Juancruz123 Juancruz123
  • 02-07-2018
  • Mathematics
contestada

Can someone explain to me how to do this problem???

Can someone explain to me how to do this problem class=

Respuesta :

nikoloidispb991t nikoloidispb991t
  • 02-07-2018
Answer is C. Mean is the mid-point value and one standard deviation on either side. (100-85=15 and 115-100=15)
Answer Link

Otras preguntas

which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud
Which word has the long i sound? relieve speciality society social
How much money, in dollars, does one mole of nickels represent?
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
I want to work with LDAP. what is LDAP?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?