kawiman92 kawiman92
  • 01-11-2018
  • Mathematics
contestada

What is 2x+4y+2=3y+5 in general form

Respuesta :

isabellahardes isabellahardes
  • 01-11-2018

2x+y=3 is the answer in standard form


Answer Link

Otras preguntas

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Un recipiente tiene una masa de 120 g. Conviértelo a lb (libras)
A time when there was something I loved that others didn't understand
Which artist determined that this new process changed the process of representing the observable world and how?
What elements have the same number of energy levels as Calcium?
Where is a metaphor at in the poem a photograph by Andrea Gibson Photograph I wish I was a photograph tucked into the corners of your wallet I wish I was a pho
Need the answer for this
What elements have the same number of energy levels as Calcium?
Which descriptions apply to Mendel’s pea plant experiments? Select three options.
Is this statement true or false?The people of Sumer planted wheat and irrigated their fields in order to have a surplus of food.truefalse