Lexsapnady Lexsapnady

01-04-2016
Biology

contestada

Nutrients supply the body with energy and maintenance materials. True Or Flase

Respuesta :

KatLena666 KatLena666

01-04-2016

It's true Food provides the body with the many materials it needs for energy, growth, repair, and reproduction. These materials are more known as nutrients.

Answer Link

bobthebuilder887766 bobthebuilder887766

07-04-2022

Answer:

True

Explanation:

Answer Link

Otras preguntas

What was the main idea of Rousseau's famous work "The Social Contract".

Use the excerpt to answer the question. We hold these truths to be self-evident: that all men and women are created equal; that they are endowed by their Creato

31. The skin, lungs, and digestive system __________. A. transport broken-down chemicals out of the body B. are not affected by drugs C. always speed up when dr

Explain the carbon cycle and explain why burning fossil fuels is an issue.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

show work and factor ?

please answer this im dying here

why are the hindlimbs important on the frog

Cheney is buying a house for $216,820. He made a down payment of $26,020 and will finance $190,800. He gets a 15 year fixed rate loan with a rate of 5.815%. Ho

During translation, the mrna is read in groups of three bases. true false