salahiw42
salahiw42 salahiw42
  • 03-05-2021
  • Mathematics
contestada

Can someone help me???

Can someone help me class=
Can someone help me class=

Respuesta :

Аноним Аноним
  • 03-05-2021

Answer:

91 cm squared

Step-by-step explanation:

13 x 7 = 91

Answer Link
alanaconley
alanaconley alanaconley
  • 03-05-2021

Answer: 77

Step-by-step explanation:

13 × 7 - (4 × 3) - (2 × 1)

Have a good day :)

Answer Link

Otras preguntas

How is the creation of public policy in Russia different from that in the United States?
Sequence the skeletal and muscular changes that take place when a person inhales
if the volume of a triangular prism is 120 base l is is 6 and base h is is 5 what is the height
Describe these small intestine structures and their functions: intestinal glands -
Which of these hormones does not help control fluid balance during exercise?
Find the length of the missing side of a right triangle if a=6 and c=11
Boris has scored 80, 93, 63, 83, and 83 on his previous five tests. what score does he need on his next test so that his average (mean) is 79?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Franklin delano roosevelt (january 30, 1882 to april 12, 1945) was the 32nd american president who led the united states through the great depression and world
Sugar melts at 367°F. What is the melting point of sugar on the Celsius scale?