an3dr0eakimbee an3dr0eakimbee
  • 03-12-2016
  • Mathematics
contestada

What is temperature of hot chocolate in degrees celsius?

Respuesta :

JonathanHagen JonathanHagen
  • 03-12-2016
Assuming it's boiling, the temperature will be 100°C, since water based materials can not exceed that without becoming a gas.
Answer Link

Otras preguntas

Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
find the prime factorization 504
define concentric circles
Which powerful religious group often tried to close the theaters in Shakespeare's time? A. the Puritans B. the King's Men C. the Pilgrims D. the Jacobites
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
round 7,782 to the nearest hundred
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
What is the adjective in the following sentence? The yellow sun hung brightly in the sky. a. Brightly b. Sun c. Yellow d. Hung