jqmiess jqmiess
  • 01-02-2022
  • Chemistry
contestada

is gravity a matter??

Respuesta :

renknee
renknee renknee
  • 01-02-2022

Answer:

No, gravity isn't matter

Explanation:

Gravity is a force that attracts matter towards the center of a physical body with mass.

Answer Link

Otras preguntas

if ABC is similar to DEF, determine the measure of A
how many significant digits in 8.90
The equilibrium price is commonly called the __________ price. A. production B. saturation C. cost-efficiency D. market-clearing
Find the area of this shape..
HELPPPPP PLSSSSSSSSSWSSSS
pls help!!!! will give brainly!!!! how to say in spanish, my friend likes to eat ice cream after school
Which of these BEST sums up the overall goal of the Cultural Revolution in China? A) drive out British merchants who continued to trade opium B) to take back t
1) Which type of increasing function eventually exceeds all other increasing functions? A) linear B) exponential polynomial D) quadratic
One way that the Texas Constitution and the U.S Constitution are similar is that both established a government divided into​
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-