alexisperezj663 alexisperezj663

04-02-2022
Physics

contestada

What is the acceleration of a car that travels in a straight line at a constant speed of 100km/h

Respuesta :

Genius365 Genius365

04-02-2022

Answer:

acceleration = 0

Explanation:

Traveling at a constant speed means the acceleration would be 0.

Answer Link

Otras preguntas

Now consider the family of lines ax + by = c such that a, b and c are consecutive multiples of each other. what would that mean? give some examples of such line

HURRY MATH QUIZ From the list, which terms are like 5x?

of the following are true about the Populist Party EXCEPT: a. It was the only third party ever to have a presidential candidate elected. b. It influenced state

2. Why does urban violence matter?

Any help ?!?!?!?!?!??

China's growing economy has been helped by special economic zones. In these zones, A. the government carefully controls the economy B. only Chinese companies ca

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

The figure below consists of a square and a right triangle. Find the missing length x.

please help ASAP!!!!40 points!!!!!!!!No fake answers!!!!!!!!!!!!need ALL answers ASAP!!!!!!!!!!!! please please please don't waste my points!!!!!!!!!!!!!!!!!!!!

how do you present yourself in spanish ?