01-03-2017
Chemistry

contestada

I need those answers

I need those answers class=

Respuesta :

Аноним Аноним

01-03-2017

BaO, Barium Oxide.

Na2SO4, Sodium Sulfate.

CuO, Copper (II) Oxide.

P2O5, Diphosphorus Pentoxide.

HNO3, Nitric Acid.

CO32-, Molecular Formula.

Hope this helps. :)

Answer Link

Otras preguntas

3) Find AB B 30° 28 59 A) 24 B) 20 C)27 D) 25

Shrill sound is of -------------- * Higher frequency Lower frequency Higher amplitude Lower amplitude

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Decide if the clue word is used for the preterit or imperfect. Write I for the imperfect and P for the preterit. anoche - generalmente - nunca - luego - mientra

Why might someone living in an area that is densely populated want to move west? Is that a push factor or a pull factor?

2|2x-6|=20 How the hell do you do this guys :(

what are the different food groups?

How can an assertive person help in resolving conflict?

Write a proportion to find how many points x a student needs to score on a test worth 50 points to get a test score of 78%

Si tomas muestras del músculo de la pierna de una persona sedentaria y de una atleta ,cuál de ellas tendría un mayor número de mitocondrial ,porque