alliespjjangSm alliespjjangSm
  • 02-05-2017
  • Physics
contestada

What is the net force acting on a 10 kg freely falling object?

Respuesta :

travxbo travxbo
  • 04-05-2017
 Force = mass * acceleration, with units kg*m / second squared, or the more commonly the Newton, N. Assuming objects freely fall due to gravity at 9.8 m/second squared, and zero air resistance force opposing the freely falling object, 1 kg * 9.8 m/second squared = 9.8 N = force on the ball.
Answer Link

Otras preguntas

who fought against each other in the crusades?
What would be the most likely effect of one company buying a competitor?
How many years does an apple tree live useful?
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
Graph the first six terms of a sequence where a1 = -10 and d = 3.
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
i need help with this question