stellarsoldiere stellarsoldiere
  • 01-10-2017
  • Mathematics
contestada

solve the following:

4x = 32

Respuesta :

Аноним Аноним
  • 01-10-2017


8 times 4 is 32
32/8 is 4

so x=8

hope it helps
Answer Link
EllerPpl
EllerPpl EllerPpl
  • 01-10-2017
X = 8
To get 8 all you do is 32 divide by 4
Hope this helps
Answer Link

Otras preguntas

Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
the perimeter of a square 116ft ?
is a centimeter one tenth or one hundredth or a meter
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity       built bridges, aqueducts and harbors       reduced taxes
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5